100% Guaranteed Results


Outbreak investigation using Machine Learning. Solved
$ 29.99
Category:

Description

5/5 – (1 vote)

You are given a data set consisting of DNA sequences (the file is available here) of the same length. Each DNA sequence is a sequence of characters from the alphabet ‘A’,’C’,’T’,’G’, and it represents a particular viral strain sampled from an infected individual. Your goal is to write a code that helps to identify socalled transmission clusters that correspond to ongoing viral outbreaks.
The sequences should be considered as feature vectors and characters – as features. The data set is stored as a fasta file, which is essentially a text file that has the following form:
>Name of Sequence1
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
>Name of Sequence2
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
>Name of Sequence3
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
Here each line starting with ‘>’ symbol contains the name of a sequence followed by the sequence itself in the next line.
1) Read sequences from the file.
2) Calculate pairwise distances between sequences. Use Hamming distance: it is the number of positions at which the sequences are different (see https://en.wikipedia.org/wiki/Hamming_distance)
3) Project the sequences in 2-D space using Multidimensional Scaling (MDS) based on Hamming distance matrix.
4) Plot the obtained 2-D data points. Estimate the number of clusters K by visual inspection.
5) Use k-means algorithm to cluster the 2-D data points.
Your submission must contain:
1) Short report that describes how you did it. The report has to include
➢ code of your script;
➢ visualization plots for MDS with different clusters highlighted in different colors. 2) Your source code written in Python (.py or .ipynb).
Do NOT use archives! No zip, rar, 7z, or tar-files are allow in the submission!

Reviews

There are no reviews yet.

Be the first to review “Outbreak investigation using Machine Learning. Solved”

Your email address will not be published. Required fields are marked *

Related products